Review





Similar Products

95
PackGene Biotech lnc aav2 7 m8 gfaabc1d shscramble egfp
Aav2 7 M8 Gfaabc1d Shscramble Egfp, supplied by PackGene Biotech lnc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shscramble+vector/AAV2+Vector+Production/pm42035927-54-1-7
Average 95 stars, based on 1 article reviews
aav2 7 m8 gfaabc1d shscramble egfp - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

96
Addgene inc shscramble vector
In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA <t>(shSCRAMBLE).</t> (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.
Shscramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shscramble+vector/scramble+shRNA+(Plasmid+%231864)/pmc12828543-406-4-8
Average 96 stars, based on 1 article reviews
shscramble vector - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
OriGene shscramble sequence as control
A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.
Shscramble Sequence As Control, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shscramble+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pmc11336179-343-27-31
Average 96 stars, based on 1 article reviews
shscramble sequence as control - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentiviral vectors shscramble
A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.
Lentiviral Vectors Shscramble, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shscramble+vector/lentiviral+vectors+shscramble/pm34528694-49-11-18
Average 90 stars, based on 1 article reviews
lentiviral vectors shscramble - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH lentiviral vectors encoding shrnas that were scrambled (shscramble) (i.e., sham) or to plin2 (shplin2)
A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.
Lentiviral Vectors Encoding Shrnas That Were Scrambled (Shscramble) (I.E., Sham) Or To Plin2 (Shplin2), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shscramble+vector/lentiviral+vectors+encoding+short+hairpin+rnas+that+were+either+scrambled++i+e+++sham++or+to+plin2++shplin2+/pmc08564404-23-13-18
Average 90 stars, based on 1 article reviews
lentiviral vectors encoding shrnas that were scrambled (shscramble) (i.e., sham) or to plin2 (shplin2) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
OriGene mel cellsc shpcbp1 cggcgtgccgcagtccgtcaccgagtgtg shpcbp2 ggcctataccattcaaggacagtatgcca shscramble tr30013 af
A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble <t>(shScramble)</t> or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.
Mel Cellsc Shpcbp1 Cggcgtgccgcagtccgtcaccgagtgtg Shpcbp2 Ggcctataccattcaaggacagtatgcca Shscramble Tr30013 Af, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shscramble+vector/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/10__1128_slash_mcb__00668___20-165-43-75
Average 95 stars, based on 1 article reviews
mel cellsc shpcbp1 cggcgtgccgcagtccgtcaccgagtgtg shpcbp2 ggcctataccattcaaggacagtatgcca shscramble tr30013 af - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

Image Search Results


In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

Journal: iScience

Article Title: Preclinical drug screen identifies WEE1 inhibitor and vinca alkaloid as a combination treatment concept for Li-Fraumeni syndrome medulloblastoma

doi: 10.1016/j.isci.2025.114564

Figure Lengend Snippet: In vivo validation of adavosertib and vincristine (VCR) in LFS SHH-MB models (A) Survival of mice injected with BT084 patient-derived xenograft (PDX) model during treatment with adavosertib and VCR; log rank test was used for statistical analysis. (B) Tumor growth dynamics of BT084 PDX model during treatment with adavosertib and vincristine (VCR): data are represented as mean ± SEM. (C) Phospho (p)-CDK1 in LFS SHH-MB PDX cells (HS231222 and LFS primary) following in vivo treatment with adavosertib and VCR: numbers below the blot represent normalized fold change relative to non-treated control. (D) Tumor growth dynamics of LFS MB PDX models expressing WEE1 shRNA (shWEE1) and control shRNA (shSCRAMBLE). (E) Survival of mice injected with LFS MB PDX models expressing shWEE1 and shSCRAMBLE; log rank test was used for statistical analysis.

Article Snippet: LFS_primary cells transduced with shSCRAMBLE vector (Plasmid #1864, Addgene) were used as a negative control.

Techniques: In Vivo, Biomarker Discovery, Injection, Derivative Assay, Control, Expressing, shRNA

A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble (shScramble) or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.

Journal: Nature Communications

Article Title: Mdm2 requires Sprouty4 to regulate focal adhesion formation and metastasis independent of p53

doi: 10.1038/s41467-024-51488-2

Figure Lengend Snippet: A , B Tumor spheroid invasion in collagen matrix after ( A ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( B ) treatment with MEL23. Representative images above and quantification below of the area invaded and the number of cells invading 24 h after implantation. C , D Tumor spheroid invasion in the collagen-BME matrix after ( C ) transfection of HT1080 p53KO cells with siRNAs against Mdm2 or ( D ) treatment with MEL23. Representative images and quantification of the area invaded 24 h after implantation. Graphs show three pooled independent experimental replicates, the total number of spheroids in each condition is: siCtrl = 10, siMdm2#1 = 15, siMdm2#2 = 12 in panel ( A ); DMSO = 25, MEL23 = 24 in panel ( B ); siCtrl = 12, siMdm2#1 = 14, siMdm2#2 = 15 in panel ( C ), and DMSO = 8, MEL23 = 9 in panel ( D ). E Representative images of cell morphology of HT1080 p53KO cells transfected with siRNAs against Mdm2 or siCtrl in collagen matrix, 6 h after implantation. F Quantification of more circular cells (circularity of 0.75 or higher) in each condition shown in ( E ), n = 3 groups. The graph represents the average fold change of more circular morphology in Mdm2 silenced cells compared to control in three independent experimental replicates. More details about the quantification can be found in the method’s session. G – I HT1080 p53KO cells stably expressing shRNA scramble (shScramble) or a pool of Mdm2 shRNAs (shMdm2) were used to analyze metastatic burden using mouse models. G Protein levels of Mdm2 and MdmX in HT1080 shScramble and shMdm2 stable cell lines. β-actin was used as a loading control. H , I Representative images above and quantification below of metastatic foci in the lungs after implantation of shScramble or shMdm2 cells using ( H ) orthotropic model, n = 4 mice/group or ( I ) tail-vein model, n = 8 mice/group. In all box and whisker plots the boxes extend from 25 to 75 percentiles and whiskers show min and max values, The line in the center of each box represents the median. Graphs shown in panels ( F , H , I ) represent the mean ± SD of independent experimental replicates. More details about the statistical tests used can be found in the Source Data file.

Article Snippet: For the single Mdm2 knockdown, HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene, cat.#TR30021).

Techniques: Transfection, Control, Stable Transfection, Expressing, shRNA, Whisker Assay